- Worldwide
- to print
Primers for Sequencing
pJET1.2 Sequencing Primers
|
- Store at -20°CpJET1.2 forward sequencing primer, 23-mer
5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
| Catalog# | Size, concentration | Certificate of Analysis | MSDS |
| SO501 | 0.2 A260, (6.7 µg) | SO501 |
pJET1.2 reverse sequencing primer, 24-mer
5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
| Catalog# | Size, concentration | Certificate of Analysis | MSDS |
| SO511 | 0.2 A260, (6.7 µg) | SO511 |
- Product information
-
- Applications
- Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2.
- Colony screening by PCR.
DescriptionSequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Quality ControlFunctionally tested by dideoxy sequencing of pJET1.2 DNA.
Patents, Licenses, Trademarks - Protocols & recommendations
