- to print

DNA/RNA Modifying Enzymes

SP6 RNA Polymerase

Product information

Features

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides).

Applications

• Synthesis of unlabeled and labeled RNA that can be used:
  – for hybridization (1), in vitro RNA translation (2);
  – as aRNA (3), siRNA (4), substrate in RNase protection assays (5), template for genomic DNA sequencing (6);
  – in studies of RNA secondary structure and RNA-protein interactions (7), RNA splicing (8).

Description

Bacteriophage SP6 RNA polymerase is DNA-dependent RNA polymerase with strict specificity for their respective double-stranded promoters. It catalyzes the 5'=>3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Source

E.coli cells with a cloned gene encoding SP6 RNA polymerase.

Molecular Weight

99 kDa monomer.

Definition of Activity Unit

One unit of the enzyme incorporates 1 nmol of AMP into a polynucleotide fraction (adsorbed on DE-81) in 60 minutes at 37°C.

Enzyme activity is assayed in the following mixture: 40 mM Tris-HCl (pH 8.0), 6 mM MgCl₂, 10 mM DTT, 2 mM spermidine, 0.5 mM of each NTP, 0.6 MBq/ml [³H]-ATP, 20 µg/ml plasmid DNA containing the appropriate promoter sequences.

Storage Buffer

Polymerase is supplied in:
50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM DTT, 0.1 mg/ml BSA, 0.03% (v/v) ELUGENT Detergent, 50% (v/v) glycerol.

5X Transcription Buffer

200 mM Tris-HCl (pH 7.9 at 25°C), 30 mM MgCl₂, 50 mM DTT, 50 mM NaCl, 10 mM spermidine.

Quality Control

The absence of endo-, exodeoxyribonucleases and ribonucleases confirmed by appropriate tests. Functionally tested in in vitro transcription reaction.

Inhibition and Inactivation

• Inhibitors: metal chelators, enzyme activity is reduced by 50% at NaCl or KCl concentration above 150 mM. Greater than 50% reduction in enzyme activity with ammonium sulphate.
• Inactivated by heating at 70°C for 10 min or by addition of EDTA.

Note

Consensus promoter sequences:
AATTAACCCTCACTAAAGGGAGA - T3
TAATACGACTCACTATAGGGAGA - T7
ATTTAGGTGACACTATAGAAGNG - SP6
The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3 are critical for transcription, and they must be a G and a purine base, respectively (9).

Patents, Licenses, Trademarks

Protocols & recommendations

RECOMMENDATIONS FOR USE

ADDITIONAL PROTOCOLS

DNA Template Preparation for in vitro Transcription

Double stranded linear DNA with blunt or 5'-protruding ends can be used as template for in vitro transcription. Linearized plasmid DNA, PCR products or cDNA can be used as templates for transcription if they contain a double-stranded RNA polymerase promoter region in the correct orientation.
Consensus promoter sequences of different RNA Polymerases:
T7 TAATACGACTCACTATAGGG
T3 AATTAACCCTCACTAAAGGG
SP6 ATTTAGGTGACACTATAGAA
G will be the first base (+1) of the RNA transcript
The synthesis of sense or antisense RNA transcripts depends on the orientation of the promoter with respect to target sequence. The target sequence must be placed downstream of the promoter for sense RNA and must be inverted for antisense RNA transcription.
Plasmid Templates
Quality
Plasmid DNA quality affects transcription yield and the integrity of synthesized RNA. The greatest transcription yields are achieved with the highest purity plasmid templates. Plasmids purified by common laboratory methods can be used if the DNA is free of contaminating RNases, SDS, EDTA, proteins, salts* and RNA. DNA should be have a A_260/280 ratio of 1.8-2.0. The GeneJET™ Plasmid Miniprep Kit generates high purity plasmid DNA suitable for transcription.
* T7 and SP6 RNA Polymerases are inhibited by ~50% at NaCl or KCl concentrations above 150 mM and T3 RNA Polymerase – at above 250 mM.
Linearization
To produce RNA transcripts of a defined length, plasmid DNA is linearized by restriction digestion downstream of the insert. Restriction enzymes which generate blunt ends or 5'-overhangs are preferred. 3'-overhangs have been reported to generate spurious transcripts (1) and should therefore be avoided. 3'-overhangs can be blunted by T4 DNA Polymerase prior to transcription.
Due to the high processivity of RNA polymerases, circular plasmid templates generate long heterogeneous RNA transcripts in higher quantities than linear templates. Therefore, it is important to completely linearize plasmid DNA to ensure efficient synthesis of defined length transcripts. If complete digestion is unachievable, gel purify the linearized DNA template band e.g. with a DNA Gel Extraction Kit prior to transcription reactions.
After linearization, it is recommended to purify the DNA template by phenol/chloroform extraction:

1. Add 1/10th volume of 3 M Sodium Acetate Solution to the DNA.
2. Mix thoroughly.
3. Extract with an equal volume of a 1:1 phenol/chloroform mixture, and then twice with an equal volume of chloroform. Collect the aqueous phase and transfer to a new tube.
4. Precipitate the DNA by adding 2 volumes of ethanol. Incubate at -20°C for at least 30 min and collect the pellet by centrifugation.
5. Remove the supernatant and rinse the pellet with 500 µl of cold 70% ethanol.
6. Resuspend the DNA in 20 µl of DEPC-treated water.

PCR Templates
PCR products can serve as templates for in vitro transcription. The RNA polymerase promoter must be located upstream of the sequence to be transcribed.

Conventional in vitro Transcription

More than 10 µg of RNA transcript can be generated per 1 µg template DNA using the following protocol. The reaction can be scaled up or down. For high yield transcription, generating up to 200 µg RNA, use TranscriptAid™ T7 High Yield Transcription Kit.

• Thaw frozen reagents, mix and centrifuge briefly.
• Keep enzymes and nucleotides on ice.
• Keep the Reaction Buffer at room temperature.

1. Prepare the following reaction mixture at room temperature:

   5X Transcription buffer	10 µl
   ATP/GTP/CTP/UTP Mix, 10 mM each	10 µl (2 mM final concentration)
   Linearized template DNA	1 µg
   RiboLock™ RNase Inhibitor	1.25 µl (50 u)
   T7/T3/SP6 RNA Polymerase	1.5 µl (30 u)
   DEPC-treated Water	to 50 µl
   Total volume	50 µl

2. Incubate at 37°C for 2 hours.
3. Optional: To remove template DNA add 2 µl (2 u) of DNase I, RNase-free, mix and incubate at 37°C for 15 min.
4. Stop the reaction by addition of 2 µl 0.5 M EDTA, pH 8.0 and incubate at 65°C for 10 min.

Note

RNA hydrolyzes if heated in the absence of a chelating agent.

Synthesis of Radiolabeled RNA Probes of High Specific Activity

1. Linearize template DNA with a restriction enzyme. Extract DNA with phenol/chloroform, then with chloroform/isoamyl alcohol, and precipitate with ethanol. Dissolve DNA in DEPC-treated Water.
2. Combine the following reaction components at room temperature in the order given:
   

   5X Transcription buffer	4 µl
   3 NTP Mix, 10 mM each* (without labeled NTP)	1 µl (0.5 mM final concentration)
   100 µM CTP	2.4 µl (12 µM final concentration)
   [alpha-32P]-CTP, ~30 TBq/mmol (800 Ci/mmol)	1.85 MBq (50 µCi)
   Linear template DNA	0.2-1.0 µg
   RiboLock™ RNase Inhibitor	0.5 µl (20 u)
   T7/T3/SP6 RNA Polymerase	1 µl (20 u)
   DEPC-treated Water	to 20 µl
   Total volume	20 µl

3. Incubate at 37°C for 2 hours.
4. Stop the reaction by cooling at -20°C.
5. Determine the percentage of the label incorporated into RNA.

Note

* To prepare a mix of the three non-labeled NTPs 10 mM each, combine 1 µl of all three NTPs, 100 mM, from the set (#R0481) with 7 µl of DEPC-treated Water. Store the mix at -20°C for further use.

• Expect specific radioactivity of 3-5 x10⁸ dpm/µg.
• RNA can be radiolabeled with [³²P], [³⁵S] or [³H]-ribonucleotides. Recommended amounts of radiolabeled nucleotides in 20 µl of reaction mixture are as follows: 1.85 MBq (50 µCi) for 5'-[alpha-³²P]-CTP, approx. 30 TBq/mmol (800 Ci/mmol); 11.1 MBq (300 µCi) for 5'-[alpha-³⁵S]-UTP, more than 37 TBq/mmol (1000 Ci/mmol); 0.925 MBq (25 µCi) for 5,6-[³H]-UTP, 1.1-2.2 TBq/mmol (30-60 Ci/mmol).
• The yield of the full-length transcripts is reduced when the concentration of labeled NTP is below 12 µM.

References

1. Melton, D.A., et al., Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter, Nucleic Acids Res.,12, 7035-7056, 1984.
2. Krieg, P.A., Melton, D.A., Functional messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs, Nucleic Acids Res., 12, 7057-7070, 1984.
3. Melton, D.A., Injected antisense RNAs specifically block messenger RNA translation in vivo, Proc. Natl. Acad. Sci. USA, 82, 144-148, 1985.
4. Bernstein, E., et al., Role for bidentate ribonuclease in the initiation step of RNA interference, Nature, 409, 363-366, 2001.
5. Peebles, C.L., et al., A self-splicing RNA excises an intron lariat, Cell, 44, 213-223, 1986.
6. Church, G.M., Gilbert, W., Genomic sequencing, Proc. Natl. Acad. Sci. USA, 81, 1991-1995, 1984.
7. Witherell, G.W., et al., Cooperative binding of R17 coat protein to RNA, Biochemistry, 29, 11051-11057, 1990.
8. Krainer, A.R., et al., Normal and mutant human beta-globin pre-mRNAs are faithfully and efficiently spliced in vitro, Cell, 36, 993-1005, 1984.
9. Jorgensen, E.D., et al., Specific contacts between the bacteriophage T3, T7, and SP6 RNA polymerases and their promoters, J. Biol. Chem., 266, 645-651, 1991.

Related products

• RiboLock™ RNase Inhibitor
• DNase I, RNase-free
• RiboRuler™ High Range RNA Ladder
• RiboRuler™ Low Range RNA Ladder
• NTP Set
• Aminoallyl-UTP
• Pyrophosphatase, Inorganic (from yeast)
• Glycogen, RNA grade
• Agarase
• 0.5 M EDTA, pH 8.0
• DEPC-treated Water