Home  Contacts  Order  Catalog  Support  Search  Alphabetical Index  Numerical Index  Restriction Enzymes  Modifying Enzymes  PCR, qPCR, RT-PCR & dNTPs  Molecular Cloning  Nucleic Acid Purification  Molecular Labeling & Detection  In vitro Transcription  Electrophoresis Products  Nucleotides  Transfection Reagents  Reagents C A T A L O G

SP6, T3, T7 RNA Polymerases

SP6 RNA Polymerase
#EP0131 Supplied with: 5X Transcription Buffer	2000 u (20 u/µl) 0.5 ml
#EP0133 Supplied with: 5X Transcription Buffer	HC, 5000 u (>100 u/µl) 1.25 ml
Related Documents (in pdf, ~40-60 KB): Certificate of Analysis: #EP0131, #EP0133 MSDS (English) MSDS (English-USA) MSDS (German)
T3 RNA Polymerase
#EP0101 Supplied with: 5X Transcription Buffer	2000 u (20 u/µl) 0.5 ml
#EP0102 #EP0103 Both supplied with: 5X Transcription Buffer	10,000 u (20 u/µl) HC, 10,000 u (>100 u/µl) 2x1.25 ml
Related Documents (in pdf, ~40-60 KB): Certificate of Analysis: #EP0101, #EP0102, #EP0103 MSDS (English) MSDS (English-USA) MSDS (German)
T7 RNA Polymerase
#EP0111 Supplied with: 5X Transcription Buffer	5000 u (20 u/µl) 1.25 ml
#EP0112 #EP0113 Both supplied with: 5X Transcription Buffer	5x5000 u (20 u/µl) HC, 25,000 u (>100 u/µl) 5x1.25 ml
Related Documents (in pdf, ~40-60 KB): Certificate of Analysis: #EP0111, #EP0112, #EP0113 MSDS (English) MSDS (English-USA) MSDS (German)

 

Feature
Incorporate modified nucleotides (e.g. biotin-, digoxigenin-, aminoallyl-, fluorescein-labeled nucleotides).

Description
Bacteriophage SP6, T3 and T7 RNA polymerases are DNA-dependent RNA polymerases with strict specificity for their respective double-stranded promoters. They catalyze the 5’=>3’ synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from their promoters.

Source
E.coli cells with a cloned gene encoding the corresponding RNA polymerase.

Molecular Weight
Approx. 98 kDa monomers.

Applications

• Synthesis of unlabeled and labeled RNA (see Protocol for Synthesis of RNA and Protocol for Synthesis of High Specific Activity Radiolabeled RNA) that can be used:
  • for hybridization (1), in vitro RNA translation (2);
  • as aRNA (3), siRNA (4), substrate in RNase protection assays (5), template for genomic DNA sequencing (6);
  • in studies of RNA secondary structure and RNA-protein interactions (7), RNA splicing (8).

Quality Control
The absence of endodeoxyribonucleases, exodeoxyribonucleases and ribonucleases confirmed by appropriate tests. Functionally tested for synthesis of strand-specific RNA sequences.

Concentration
20 u/µl; >100 u/µl, HC

Definition of Activity Unit
One unit of the enzyme incorporates 1 nmol of AMP into a polynucleotide fraction (adsorbed on DE-81) in 60 minutes at 37°C.
Enzyme activity is assayed in the following mixture: 40 mM Tris-HCl (pH 8.0), 6 mM MgCl₂, 10 mM DTT, 2 mM spermidine, 0.5 mM of each NTP, 0.6 MBq/ml [³H]-ATP, 20 µg/ml plasmid DNA containing the respective promoter sequence.

Storage Buffer
Each of polymerases is supplied in: 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM DTT, 0.1 mg/ml BSA, 0.5 mM ELUGENT Detergent and 50% (v/v) glycerol.

5X Transcription Buffer
200 mM Tris-HCl (pH 7.9 at 25°C), 30 mM MgCl₂, 50 mM DTT, 50 mM NaCl and 10 mM spermidine.

Inhibition and Inactivation

• Inhibitors: metal chelators, approximately one-half of the enzyme activity is observed at NaCl or KCl concentration above 150 mM (SP6 and T7 RNA Polymerases) or above 250 mM (T3 RNA Polymerase). Ammonium sulphate inhibits the enzymes even more strongly.
• Inactivated by heating at 70°C for 10 min or the addition of EDTA.

Note
Consensus promoter sequences:

    -15  -10   -5   +1  +5
T3  AATTAACCCTCACTAAAGGGAGA
T7  TAATACGACTCACTATAGGGAGA
SP6 ATTTAGGTGACACTATAGAAGNG

The promoters of the three phages share a consensus sequence that is thought to consist of two domains. A highly conserved core region (-7 - +1) interacts with the common structures of the polymerases. In contrast, regions that are responsible for specific promoter recognition (-12 - -8) are significantly more variable (9). The position +1 indicates the first nucleotide incorporated into the synthesized RNA during transcription. Only bases at positions +1 through +3 are critical for transcription, and they must be a G and a purine base, respectively.

Related Products

RiboLock™ RNase Inhibitor DNase I, RNase-free T7 Transcription Kit Aminoallyl-UTP RiboRuler™ RNA Ladders NTP Set Agarase Pyrophosphatase, Inorganic (from yeast) 0.5 M EDTA, pH 8.0 DEPC-treated Water

References

1. Melton, D.A., et al., Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter, Nucleic Acids Res.,12, 7035-7056, 1984.

2. Krieg, P.A., Melton, D.A., Functional messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs, Nucleic Acids Res., 12, 7057-7070, 1984.
3. Melton, D.A., Injected antisense RNAs specifically block messenger RNA translation in vivo, Proc. Natl. Acad. Sci. USA, 82, 144-148, 1985.
4. Bernstein, E., et al., Role for bidentate ribonuclease in the initiation step of RNA interference, Nature, 409, 363-366, 2001.
5. Peebles, C.L., et al., A self-splicing RNA excises an intron lariat, Cell, 44, 213-223, 1986.
6. Church, G.M., Gilbert, W., Genomic sequencing, Proc. Natl. Acad. Sci. USA, 81, 1991-1995, 1984.
7. Witherell, G.W., et al., Cooperative binding of R17 coat protein to RNA, Biochemistry, 29, 11051-11057, 1990.
8. Krainer, A.R., et al., Normal and mutant human b-globin pre-mRNAs are faithfully and efficiently spliced in vitro, Cell, 36, 993-1005, 1984.
9. Jorgensen, E.D., et al., Specific contacts between the bacteriophage T3, T7, and SP6 RNA polymerases and their promoters, J. Biol. Chem., 266, 645-651, 1991.

Updated kovo 18, 2008 10:07